NEET 2024 questions
160 questions, by subject. Each opens with its options and answer.
Zoology
- Match List I with List II : List I A. Down's syndrome B. α-Thalassemia C. β-Thalassemia D. Klinefelter's syndrome List II I. 11th chromosome II. 'X' chromosome III. 21st chromosome IV. 16th chromosome Choose the correct…
Reproductive Health
- Match List I with List II : List I (Sub Phases of Prophase I) A. Diakinesis B. Pachytene C. Zygotene D. Leptotene List II (Specific Characters) I. Synaptonemal complex formation II. Completion of termalisation of…
Human Reproduction
- Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?
Breathing and Exchange of Gases
- Match List I with List II : List I A. Typhoid B. Leishmaniasis C. Ringworm D. Filariasis List II I. Fungus II. Nematode III. Protozoa IV. Bacteria Choose the correct answer from the options given below :
Human Health and Disease
- Match List I with List II : List I A. Expiratory capacity B. Functional residual capacity C. Vital capacity D. Inspiratory capacity List II I. Expiratory reserve volume + Tidal volume + Inspiratory reserve volume II.…
Breathing and Exchange of Gases
- Which of the following are Autoimmune disorders? A. Myasthenia gravis B. Rheumatoid arthritis C. Gout D. Muscular dystrophy E. Systemic Lupus Erythematosus (SLE) Choose the appropriate answer from the options given…
Human Health and Disease
- Given below are two statements : Statement I : In the nephron, the descending limb of loop of Henle is impermeable to water and permeable to electrolytes. Statement II : The proximal convoluted tubule is lined by simple…
Excretory Products and Elimination
- Which of the following is not a steroid hormone?
Chemical Coordination and Integration
- Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R : Assertion A : FSH acts upon ovarian follicles in female and Leydig cells in male. Reason R : Growing ovarian…
Chemical Coordination and Integration
- Given below are some stages of human evolution. Arrange them in correct sequence. (Past to Recent) A. Homo habilis B. Homo sapiens C. Homo neanderthalensis D. Homo erectus Choose the correct sequence of human evolution…
Evolution
- Match List I with List II : List I A. Cocaine B. Heroin C. Morphine D. Marijuana List II I. Effective sedative in surgery II. Cannabis sativa III. Erythroxylum IV. Papaver somniferum Choose the correct answer from the…
Human Health and Disease
- The 'Ti plasmid' of Agrobacterium tumefaciens stands for
Animal Husbandry
- Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'
Biomolecules
- Match List I with List II : List I A. Pterophyllum B. Myxine C. Pristis D. Exocoetus List II I. Hag fish II. Saw fish III. Angel fish IV. Flying fish Choose the correct answer from the options given below :
Animal Kingdom
- Match List I with List II : List I A. Fibrous joints B. Cartilaginous joints C. Hinge joints D. Ball and socket joints List II I. Adjacent vertebrae, limited movement II. Humerus and Pectoral girdle, rotational movement…
Locomotion and Movement
- The flippers of the Penguins and Dolphins are the example of
Evolution
- Match List I with List II : List I A. α-1 antitrypsin B. Cry IAb C. Cry IAc D. Enzyme replacement therapy List II I. Cotton bollworm II. ADA deficiency III. Emphysema IV. Corn borer Choose the correct answer from the…
Human Health and Disease
- Match List I with List II : List I A. Axoneme B. Cartwheel pattern C. Crista D. Satellite List II I. Centriole II. Cilia and flagella III. Chromosome IV. Mitochondria Choose the correct answer from the options given…
Locomotion and Movement
- Given below are two statements. One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : Breast-feeding during initial period of infant growth is recommended by doctors for bringing a healthy…
Reproductive Health
- Which of the following is not a component of Fallopian tube?
Human Reproduction
- Which of the following statements is incorrect?
Human Reproduction
- Match List I with List II : List I A. Pons B. Hypothalamus C. Medulla D. Cerebellum List II I. Provides additional space for Neurons, regulates posture and balance. II. Controls respiration and gastric secretions. III.…
Neural Control and Coordination
- Match List-I with List-II : List-I A. Lipase B. Nuclease C. Protease D. Amylase List-II I. Peptide bond II. Ester bond III. Glycosidic bond IV. Phosphodiester bond Choose the correct answer from the options given below :
Digestion and Absorption
- Which of the following is not a natural/traditional contraceptive method?
Reproductive Health
- Following are the stages of pathway for conduction of an action potential through the heart A. AV bundle B. AV node C. SA node D. Purkinje fibres E. Bundle branches Choose the correct sequence of pathway from the…
Body Fluids and Circulation
- Match List I with List II : List I A. Pleurobrachia B. Radula C. Stomochord D. Air bladder List II I. Mollusca II. Ctenophora III. Osteichthyes IV. Hemichordata Choose the correct answer from the options given below :
Animal Kingdom
- Match List I with List II : List I A. Common cold B. Haemozoin C. Widal test D. Allergy List II I. Plasmodium II. Typhoid III. Rhinoviruses IV. Dust mites Choose the correct answer from the options given below :
Human Health and Disease
- Consider the following statements : A. Annelids are true coelomates B. Poriferans are pseudocoelomates C. Aschelminthes are acoelomates D. Platyhelminthes are pseudocoelomates Choose the correct answer from the options…
Animal Kingdom
- In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on
Structural Organisation in Animals
- Given below are two statements: Statement I : The presence of absence of hymen is not a reliable indicator of virginity. Statement II : The hymen is torn during the first coitus only. In the light of the above…
Reproductive Health
- Which one of the following factors will not affect the Hardy-Weinberg equilibrium?
Evolution
- Match List I with List II : List I A. Non-medicated IUD B. Copper releasing IUD C. Hormone releasing IUD D. Implants List II I. Multiload 375 II. Progestogens III. Lippes loop IV. LNG-20 Choose the correct answer from…
Reproductive Health
- Following are the stages of cell division : A. Gap 2 phase B. Cytokinesis C. Synthesis phase D. Karyokinesis E. Gap 1 phase Choose the correct sequence of stages from the options given below :
Biomolecules
- Choose the correct statement given below regarding juxta medullary nephron.
Excretory Products and Elimination
- The following are the statements about non-chordates. A. Pharynx is perforated by gill slits. B. Notochord is absent. C. Central nervous system is dorsal. D. Heart is dorsal if present. E. Post anal tail is absent.…
Animal Kingdom
- Given below are two statements: Statement I: Mitochondria and chloroplasts both double membranes bound organelles. Statement II: Inner membrane of mitochondria is relatively less permeable, as compared chloroplast. In…
Biomolecules
- Regarding catalytic cycle of an enzyme action, select the correct sequential steps : A. Substrate enzyme complex formation. B. Free enzyme ready to bind with another substrate. C. Release of products. D. Chemical bonds…
Biomolecules
- Match List I with List II : List I A. P wave B. QRS complex C. T wave D. T-P gap List II I. Heart muscles are electrically silent. II. Depolarisation of atria. III. Repolarisation of ventricles. IV. Depolarisation of…
Body Fluids and Circulation
- Given below are two statements : Statement I : Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are produced. Statement II : Both bone marrow and thymus provide micro environments for…
Human Health and Disease
- Match List I with List II : List I A. Unicellular glandular epithelium B. Compound epithelium C. Multicellular glandular epithelium D. Endocrine glandular epithelium List II I. Salivary glands II. Pancreas III. Goblet…
Structural Organisation in Animals
- Given below are two statements: Statement I : The cerebral hemispheres are connected by a nerve tract known as corpus callosum. Statement II : The brain stem consists of the medulla oblongata, pons and cerebellum. In…
Neural Control and Coordination
- Match List I with List II : List I A. RNA polymerase III B. Termination of transcription C. Splicing of Exons D. TATA box List II I. snRNPs II. Promoter III. Rho factor IV. SnRNAs, tRNA Choose the correct answer from…
Biomolecules
- Match List I with List II : List I A. Mesozoic Era B. Proterozoic Era C. Cenozoic Era D. Paleozoic Era List II I. Lower invertebrates II. Birds & Amphibia III. Birds & Reptiles IV. Mammals Choose the correct answer from…
Evolution
- Given below are two statements: Statement I: Gause's competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely. Statement II: According to…
Evolution
- Match List I with List II : List I A. Exophthalmic goiter B. Acromegaly C. Cushing's syndrome D. Cretinism List II I. Excess secretion of cortisol, moon face & hyperglycemia. II. Hypo-secretion of thyroid hormone and…
Chemical Coordination and Integration
- As per ABO blood grouping system, the blood group of father is B°, mother is A° and child is O°. Their respective genotype can be A. IᴬIᴬIᴿ B. IᴬIᴿIᴬIᴿ C. IᴬIᴬIᴿ D. IᴬIᴿIᴿIᴿ E. IᴬIᴿIᴿIᴿ Choose the most appropriate…
Body Fluids and Circulation
- Match List I with List II related to digestive system of cockroach. List I A. The structures used for storing of food B. Ring of 6-8 blind tubules at junction of foregut and midgut. C. Ring of 100-150 yellow coloured…
Structural Organisation in Animals
Botany
- List of endangered species was released by
Biodiversity and Conservation
- The type of conservation in which the threatened species are taken out from their natural habitat and placed in special setting where they can be protected and given special care is called
Biodiversity and Conservation
- Which one of the following can be explained on the basis of Mendel's Law of Dominance? A. Out of one pair of factors one is dominant and the other is recessive. B. Alleles do not show any expression and both the…
Principles of Inheritance
- The lactose present in the growth medium of bacteria is transported to the cell by the action of
Molecular Basis of Inheritance
- Match List I with List II List I A. Clostridium butylicum B. Saccharomyces cerevisiae C. Trichoderma polysporum D. Streptococcus sp. List II I. Butyric acid II. Ethanol III. Cyclosporin-A IV. Streptokinase Choose the…
Microbes in Human Welfare
- The equation of Verhulst-Pearl logistic growth is dN/dt = rN [(K-N)/K ]. From this equation, K indicates:
Organisms and Populations
- A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;
Molecular Basis of Inheritance
- Formation of interfascicular cambium from fully developed parenchyma cells is an example for
Anatomy of Flowering Plants
- Match List I with List II List-I A. Rhizopus B. Ustilago C. Puccinia D. Agaricus List-II I. Mushroom II. Smut fungus III. Bread mould IV. Rust fungus Choose the correct answer from the options given below:
Plant Kingdom
- What is the fate of a piece of DNA carrying only gene of interest which is transferred into an alien organism? A. The piece of DNA would be able to multiply itself independently in the progeny cells of the organism. B.…
Biotechnology
- Match List I with List II List-I A. Nucleolus B. Centriole C. Leucoplasts D. Golgi apparatus List-II I. Site of formation of glycolipid II. Organization like the cartwheel III. Site for active ribosomal RNA synthesis…
Cell Structure and Function
- Spindle fibers attach to kinetochores of chromosomes during
Cell Cycle and Division
- These are regarded as major causes of biodiversity loss: A. Over exploitation B. Co-extinction C. Mutation D. Habitat loss and fragmentation E. Migration Choose the correct option:
Biodiversity and Conservation
- Lecithin, a small molecular weight organic compound found in living tissues, is an example of:
Cell Structure and Function
- Identify the set of correct statements: A. The flowers of Vallisneria are colourful and produce nectar. B. The flowers of water lily are not pollinated by water. C. In most of water-pollinated species, the pollen grains…
Sexual Reproduction in Flowering Plants
- The cofactor of the enzyme carboxypeptidase is:
Mineral Nutrition
- Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of:
Respiration in Plants
- Which of the following is an example of actinomorphic flower?
Morphology of Flowering Plants
- Given below are two statements: Statement I: Chromosomes become gradually visible under light microscope during leptotene stage. Statement II: The beginning of diplotene stage is recognized by dissolution of…
Cell Cycle and Division
- Given below are two statements: Statement I: Parenchyma is living but collenchyma is dead tissue. Statement II: Gymnosperms lack xylem vessels but presence of xylem vessels is the characteristic of angiosperms. In the…
Anatomy of Flowering Plants
- Given below are two statements: Statement I: Bt toxins are insect group specific and coded by a gene cry IAc. Statement II: Bt toxin exists as inactive protoxin in B. thuringiensis. However, after ingestion by the…
Biotechnology
- Which one of the following is not a criterion for classification of fungi?
Diversity in Living World
- The capacity to generate a whole plant from any cell of the plant is called
Plant Growth and Development
- Which of the following are required for the dark reaction of photosynthesis? A. Light B. Chlorophyll C. CO_2 D. ATP E. NADPH Choose the correct answer from the options given below:
Photosynthesis
- Tropical regions show greatest level of species richness because A. Tropical latitudes have remained relatively undisturbed for millions of years, hence more time was available for species diversification. B. Tropical…
Biodiversity and Conservation
- How many molecules of ATP and NADPH are required for every molecule of CO_2 fixed during the Calvin cycle?
Photosynthesis
- In a plant, black seed color (BB/Bb) is dominant over white seed color (bb). In order to find out the genotype of the black seed plant, with which of the following genotype will you cross it?
Principles of Inheritance
- Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of:
Molecular Basis of Inheritance
- Bulliform cells are responsible for
Anatomy of Flowering Plants
- Match List I with List II List I A. Two or more alternative forms of a gene B. Cross of F_1 progeny with homozygous recessive parent C. Cross of F_1 progeny with any of the parents D. Number of chromosome sets in short…
Principles of Inheritance
- Match List I with List II List I A. Rose B. Pea C. Cotton D. Mango List II I. Twisted aestivation II. Perigynous flower III. Drupe IV. Marginal placentation Choose the correct answer from the options given below:
Morphology of Flowering Plants
- The DNA present in chloroplast is:
Molecular Basis of Inheritance
- Match List I with List II List I A. Robert May B. Alexander von Humboldt C. Paul Ehrlich D. David Tilman List II I. Species-Area relationship II. Long term ecosystem experiment using out door plots III. Global species…
Biodiversity and Conservation
- Given below are two statements: Statement I: In C3 plants, some O2 binds to RuBisCO, hence CO2 fixation is decreased. Statement II: In C4 plants, mesophyll cells show very little photorespiration while bundle sheath…
Photosynthesis
- Identify the steps of tricarboxylic acid cycle, which does not involve oxidation of substrate.
Respiration in Plants
- Match List I with List II List I A. Citric acid cycle B. Glycolysis C. Electron transport system D. Proton gradient List II I. Cytoplasm II. Mitochondrial matrix III. Intermembrane space of mitochondria IV. Inner…
Respiration in Plants
- Which of the following are fused in somatic hybridization involving two varieties of plants?
Biotechnology
- Match List-I with List-II List-I A. GLUT-4 B. Insulin C. Trypsin D. Collagen List-II I. Hormone II. Enzyme III. Intercellular ground substance IV. Enables glucose transport into cells Choose the correct answer from the…
Cell Structure and Function
- Match List I with List II List I (Types of Stamens) A. Monoadelphous B. Diadelphous C. Polyadelphous D. Epiphyllous List II (Example) I. Citrus II. Pea III. Lily IV. China-rose Choose the correct answer from the options…
Morphology of Flowering Plants
- Read the following statements and choose the set of correct statements: In the members of Phaeophyceae, A. Asexual reproduction occurs usually by biflagellate zoospores. B. Sexual reproduction is by oogamous method…
Plant Kingdom
- Match List I with List II List I A. Frederick Griffith B. Francois Jacob & Jacque Monod C. Har Gobind Khorana D. Meselson & Stahl List II I. Genetic code II. Semi-conservative mode of DNA replication III. Transformation…
Molecular Basis of Inheritance
- Which of the following statement is correct regarding the process of replication in E.coli?
Molecular Basis of Inheritance
- Spraying sugarcane crop with which of the following plant growth regulators, increases the length of stem, thus, increasing the yield?
Plant Growth and Development
- In an ecosystem if the Net Primary Productivity (NPP) of first trophic level is 100x (kcal m^-2) yr^-1, what would be the GPP (Gross Primary Productivity) at the third trophic level of the same ecosystem?
Ecosystem
Chemistry
- Match List I with List II. List I (Process) A. Isothermal process B. Isochoric process C. Isobaric process D. Adiabatic process List II (Conditions) I. No heat exchange II. Carried out at constant temperature III.…
Chemical Thermodynamics
- Given below are two statements. Statement I: The boiling point of three isomeric pentanes follows the order n\-pentane > isopentane > neopentane. Statement II: When branching increases, the molecule attains a shape of…
Hydrocarbons
- Match List I with List II. List I (Molecule) A. ethane B. ethene C. carbon molecule, C_3 D. ethyne List II (Number and types of bonds between two carbon atoms) I. one \σ-bond and two \π-bonds II. two \π-bonds III. one…
Chemical Bonding
- Match List I with List II. List I (Quantum Number) A. m_l B. m_s C. l D. n List II (Information provided) I. Shape of orbital II. Size of orbital III. Orientation of orbital IV. Orientation of spin of electron
Atomic Structure
- Spin only magnetic moment is same for which of the following ions? A. Ti^3+ B. Cr^3+ C. Mn^2+ D. Fe^3+ E. Sc^3+ Choose the most appropriate answer from the options given below:
d- and f-Block Elements
- On heating, some solid substances change from solid to vapour state without passing through liquid state. The technique used for the purification of such solid substances based on the above principle is known as
Practical Chemistry
- The energy of an electron in the ground state (n = 1) for He^+ ion is -x J, then that for an electron in n = 2 state for Be^3+ ion in J is
Atomic Structure
- Activation energy of any chemical reaction can be calculated if one knows the value of
Chemical Kinetics
- Given below are two statements: Statement I: The boiling point of hydrides of Group 16 follows the order H_2O > H_2Te > H_2Se > H_2S. Statement II: On the basis of molecular mass, H_2O is expected to have lower boiling…
p-Block Elements
- The reagents with which glucose does not react to give the corresponding tests/products are A. Tollen's reagent B. Schiff's reagent C. HCN D. NH_4OH E. NaHSO_3 Choose the correct options from the given below:
Biomolecules
- Arrange the following elements in increasing order of first ionization enthalpy. Li, Be, B, C, N Choose the correct answer from the options given below:
Periodic Classification
- Arrange the following elements in increasing order of electronegativity: N, O, F, C, Si Choose the correct answer from the options given below:
Periodic Classification
- The E^\circ value for the Mn^3+/Mn^2+ couple is more positive than that of Cr^3+/Cr^2+ or Fe^3+/Fe^2+ due to change of
d- and f-Block Elements
- Match List I with List II. List I (Compound) A. NH_3 B. BrF_5 C. XeF_4 D. SF_4 List II (Shape/geometry) I. Trigonal Pyramidal II. Square Planar III. Octahedral IV. Square Pyramidal Choose the correct answer from the…
Chemical Bonding
- Match List I with List II. List I (Complex) A. [Co(NH_3)_5(NO_2)]Cl_2 B. [Co(NH_3)_5(SO_4)]Br C. [Co(NH_3)_5(Cl)]Cl_2 D. [Co(H_2O)_6]Cl_3 List II (Type of isomerism) I. Solvate isomerism II. Ionization isomerism III.…
Coordination Compounds
- Given below are two statements: Statement I: Aniline does not undergo Friedel-Crafts alkylation reaction. Statement II: Aniline cannot be prepared through Gabriel synthesis. In the light of the above statements, choose…
Amines and Nitrogen Compounds
- The highest number of helium atoms is in
Some Basic Concepts of Chemistry
- Fehling's solution 'A' is
Practical Chemistry
- For the reaction 2A \ leftharpoons B + C, K_c = 4 \× 10^-3. At a given time, the composition of reaction mixture is: [A] = [B] = [C] = 2 \× 10^-4 M. Then, which of the following is correct?
Equilibrium
- The Henry's law constant (K_H) values of three gases (A, B, C) in water at 298 K are 145, 2 \× 10^-5 and 35 kbar, respectively. The solubility of these gases in water follow the order:
Solutions
- A compound with a molecular formula of C_6H_14 has two tertiary carbons. Its IUPAC name is:
Hydrocarbons
- In which of the following equilibria, K_P and K_c are NOT equal?
Equilibrium
- Which reaction is NOT a redox reaction?
Redox and Electrochemistry
- Given below are two statements: Statement I: Both [Co(NH_3)_6]^3+ and [CoF_6]^3- complexes are octahedral but differ in their magnetic behaviour. Statement II: [Co(NH_3)_6]^3+ is diamagnetic whereas [CoF_6]^3- is…
Coordination Compounds
- 1 gram of NaOH present in its solution was treated with 25 mL of 0.75 M HCl solution, the mass of sodium hydroxide left unreacted is equal to
Some Basic Concepts of Chemistry
- Among Group 16 elements, which one does NOT show -2 oxidation state?
p-Block Elements
- In which of the following processes entropy increases? A. A liquid evaporates to vapour. B. Temperature of a crystalline solid lowered from 130 K to 0 K. C. 2NaHCO_3(s) \ arrow Na_2CO_3(s) + CO_2(g) + H_2O_(g) D.…
Chemical Thermodynamics
- Match List I with List II. List I (Conversion) A. 1 mol of H_2O to O_2 B. 1 mol of MnO_4^- to Mn^2+ C. 1.5 mol of Ca from molten CaCl_2 D. 1 mol of FeO to Fe_2O_3 List II (Number of Faraday required) I. 3F II. 2F III.…
Redox and Electrochemistry
- Consider the following reaction in a sealed vessel at equilibrium with concentrations of N_2 = 3.0 × 10^-3 M, O_2 = 4.2 × 10^-3 M and NO = 2.8 × 10^-3 M. 2mathrmNO_(g) leftharpoons mathrmN_2(g) + mathrmO_2(g) If 0.1 mol…
Equilibrium
- The products A and B obtained in the following reactions, respectively, are 3ROH + PCl_3 arrow 3RCl + A ROH + PCl_5 arrow RCl + HCl + B
Alcohols Phenols and Ethers
- Given below are certain cations. Using inorganic qualitative analysis, arrange them in increasing group number from II to VI. A. mathrmAl^3+ B. mathrmCu^2+ C. mathrmBa^2+ D. mathrmCo^2+ E. mathrmMg^2+ Choose the correct…
Practical Chemistry
- During the preparation of Mohr's salt solution (Ferrous ammonium sulphate), which of the following acid is added to prevent hydrolysis of mathrmFe^2+ ion?
Practical Chemistry
- The work done during reversible isothermal expansion of one mole of hydrogen gas at 25 °C from pressure of 20 atmosphere to 10 atmosphere is (Given R = 2.0 cal mathrmK^-1 mathrmmol^-1)
Chemical Thermodynamics
- The plot of osmotic pressure (Pi) vs concentration (mol mathrmL^-1) for a solution gives a straight line with slope 25.73 L bar mathrmmol^-1. The temperature at which the osmotic pressure measurement is done is (Use R =…
Solutions
- A compound X contains 32% of A, 20% of B and remaining percentage of C. Then, the empirical formula of X is (Given atomic masses of A = 64; B = 40; C = 32 u)
Some Basic Concepts of Chemistry
- The rate of a reaction quadruples when temperature changes from 27 °C to 57 °C. Calculate the energy of activation. (Given R = 8.314 J mathrmK^-1 mathrmmol^-1, log 4 = 0.6021)
Chemical Kinetics
- Identify the correct answer.
Periodic Classification
- The pair of lanthanoid ions which are diamagnetic is
d- and f-Block Elements
- Given below are two statements: Statement I: [Co(NH_3)_6]^3+ is a homoleptic complex whereas [Co(NH_3)_4Cl_2]^+ is a heteroleptic complex. Statement II: Complex [Co(NH_3)_6]^3+ has only one kind of ligands but…
Coordination Compounds
- Mass in grams of copper deposited by passing 9.6487 A current through a voltmeter containing copper sulphate solution for 100 seconds is (Given : Molar mass of Cu = 63 g mathrmmol^-1, 1 F = 96487 C)
Redox and Electrochemistry
Physics
- A wire of length l and resistance 100 Ω is divided into 10 equal parts. The first 5 parts are connected in series while the next 5 parts are connected in parallel. The two combinations are again connected in series. The…
Current Electricity
- The mass of a planet is 1/10th that of the earth and its diameter is half that of the earth. The acceleration due to gravity on that planet is:
Gravitation
- Choose the correct answer from the options given below: A. The energy of a photon is E = hν. B. The velocity of a photon is c. C. The momentum of a photon, p = (hν)/c. D. In a photon-electron collision, both total…
Dual Nature of Radiation
- The maximum elongation of a steel wire of 1 m length if the elastic limit and its Young's modulus, respectively, are 8 × 10^8 N m^-2 and 2 × 10^11 N m^-2 is:
Properties of Matter
- The moment of inertia of a thin rod about an axis passing through its mid point and perpendicular to the rod is 2400 g cm^2. The length of the rod (400 g rod) is nearly:
Rotational Motion
- In a vernier callipers, (N + 1) divisions of vernier scale coincide with N divisions of main scale. If 1 MSD represents 0.1 mm, the vernier constant (in cm) is:
Physical World and Measurement
- Match List I with List II. List I (Spectral Lines of Hydrogen for transitions from): A. n_2 = 3 to n_1 = 2 B. n_2 = 4 to n_1 = 2 C. n_2 = 5 to n_1 = 2 D. n_2 = 6 to n_1 = 2 List II (Wavelengths (nm)): I. 410.2 II. 434.1…
Atoms and Nuclei
- If the monochromatic source in Young's double slit experiment is replaced by white light, then
Wave Optics
- Match List-I with List-II. List-I (Material): A. Diamagnetic B. Ferromagnetic C. Paramagnetic D. Non-magnetic List-II (Susceptibility (χ)): I. χ = 0 II. 0 > χ > -1 III. χ >> 1 IV. 0 < χ < ε (a small positive number)…
Magnetism and Moving Charges
- An unpolarised light beam strikes a glass surface at Brewster's angle. Then
Wave Optics
- A particle moving with uniform speed in a circular path maintains:
Kinematics
- The quantities which have the same dimensions as those of solid angle are:
Physical World and Measurement
- A bob is whirled in a horizontal plane by means of a string with an initial speed of ω rpm. The tension in the string is T. If speed becomes 2ω while keeping the same radius, the tension in the string becomes:
Laws of Motion
- If x = 5sin (π t + (π)/3 ) m represents the motion of a particle executing simple harmonic motion, the amplitude and time period of motion, respectively, are:
Oscillations and Waves
- Given below are two statements: Statement I: Atoms are electrically neutral as they contain equal number of positive and negative charges. Statement II: Atoms of each element are stable and emit their characteristic…
Atoms and Nuclei
- In an ideal transformer, the turns ratio is N_p/N_s = 1/2. The ratio V_s : V_p is equal to (the symbols carry their usual meaning):
Electromagnetic Induction and AC
- Two bodies A and B of same mass undergo completely inelastic one dimensional collision. The body A moves with velocity v_1 while body B is at rest before collision. The velocity of the system after collision is v_2. The…
Work Energy and Power
- Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: The potential (V) at any axial point, at 2 m distance (r) from the centre of the dipole of dipole moment…
Electrostatics
- A thin flat circular disc of radius 4.5 cm is placed gently over the surface of water. If surface tension of water is 0.07 N m^-1, then the excess force required to take it away from the surface is:
Properties of Matter
- A small telescope has an objective of focal length 140 cm and an eye piece of focal length 5.0 cm. The magnifying power of telescope for viewing a distant object is
Ray Optics
- Two heaters A and B have power rating of 1 kW and 2 kW, respectively. Those two are first connected in series and then in parallel to a fixed power source. The ratio of power outputs for these two cases is:
Current Electricity
- If the mass of the bob in a simple pendulum is increased to thrice its original mass and its length is made half its original length, then the new time period of oscillation is x/2 times its original time period. The…
Oscillations and Waves
- A parallel plate capacitor is charged by connecting it to a battery through a resistor. If I is the current in the circuit, then in the gap between the plates:
Electrostatics
- A metallic bar of Young's modulus, 0.5 × 10^11 N m^-2 and coefficient of linear thermal expansion 10^-5 °C^-1, length 1 m and area of cross-section 10^-3 m^2 is heated from 0°C to 100°C without expansion or bending. The…
Properties of Matter
- The property which is not of an electromagnetic wave travelling in free space is that:
Electromagnetic Waves
- The minimum energy required to launch a satellite of mass m from the surface of earth of mass M and radius R in a circular orbit at an altitude of 2R from the surface of the earth is:
Gravitation
- If the plates of a parallel plate capacitor connected to a battery are moved close to each other, then A. the charge stored in it, increases. B. the energy stored in it, decreases. C. its capacitance increases. D. the…
Electrostatics
- A force defined by F = α t^2 + β t acts on a particle at a given time t. The factor which is dimensionless, if α and β are constants, is:
Physical World and Measurement
- A sheet is placed on a horizontal surface in front of a strong magnetic pole. A force is needed to: A. hold the sheet there if it is magnetic. B. hold the sheet there if it is non-magnetic. C. move the sheet away from…
Magnetism and Moving Charges
Practise NEET every day
Five real previous-year questions a day, graded as the exam grades. No sign-up.
Start today's five