NEET 2023 questions
176 questions, by subject. Each opens with its options and answer.
Zoology
- Match List I with List II. List I List II A. Vasectomy I. Oral method B. Coitus interruptus II. Barrier method C. Cervical caps III. Surgical method D. Saheli IV. Natural method Choose the correct answer from the…
Reproductive Health
- Given below are two statements: Statement I: Vas deferens receives a duct from seminal vesicle and opens into urethra as the ejaculatory duct. Statement II: The cavity of the cervix is called cervical canal which along…
Reproductive Health
- Which of the following statements is correct?
Reproductive Health
- Which one of the following common sexually transmitted diseases is completely curable when detected early and treated properly?
Reproductive Health
- Match List I with List II. List I List II A. Heroin I. Effect on cardiovascular system B. Marijuana II. Slow down body function C. Cocaine III. Painkiller D. Morphine IV. Interfere with transport of dopamine Choose the…
Human Health and Disease
- Match List I with List II. List I (Type of Joint) List II (Found between) A. Cartilaginous Joint I. Between flat skull bones B. Ball and Socket Joint II. Between adjacent vertebrae in vertebral column C. Fibrous Joint…
Locomotion and Movement
- Given below are two statements: Statement I: A protein is imagined as a line, the left end represented by first amino acid (C-terminal) and the right end represented by last amino acid (N-terminal). Statement II: Adult…
Biomolecules
- Which of the following are NOT considered as the part of endomembrane system? A. Mitochondria B. Endoplasmic reticulum C. Chloroplasts D. Golgi complex E. Peroxisomes Choose the most appropriate answer from the options…
Biomolecules
- Given below are two statements: Statement I: RNA mutates at a faster rate. Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster. In the light of the above statements, choose the correct…
Evolution
- Match List I with List II. List I List II A. CCK I. Kidney B. GIP II. Heart C. ANF III. Gastric gland D. ADH IV. Pancreas Choose the correct answer from the options given below :
Chemical Coordination and Integration
- Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: Endometrium is necessary for implantation of blastocyst. Reason R: In the absence of fertilization, the…
Human Reproduction
- Match List I with List II. List I List II A. Ringworm I. Haemophilus influenzae B. Filariasis II. Trichophyton C. Malaria III. Wuchereria bancrofti D. Pneumonia IV. Plasmodium vivax Choose the correct answer from the…
Human Health and Disease
- Given below are two statements : Statement I : Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat. Statement…
Biomolecules
- Match List I with List II. List I List II A. Taenia I. Nephridia B. Paramoecium II. Contractile vacuole C. Periplaneta III. Flame cells D. Pheretima IV. Urecose gland Choose the correct answer from the options given…
Excretory Products and Elimination
- Which one of the following techniques does not serve the purpose of early diagnosis of a disease for its early treatment?
Human Health and Disease
- Match List I with List II. List I (Interacting species) List II (Name of interaction) A. A Leopard and a Lion in a forest/grassland I. Competition B. A Cuckoo laying egg in a Crow's nest II. Brood parasitism C. Fungi…
Evolution
- Given below are two statements: Statement I: Ligaments are dense irregular tissue. Statement II: Cartilage is dense regular tissue. In the light of the above statements, choose the correct answer from the options given…
Structural Organisation in Animals
- Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA…
Biomolecules
- Match List I with List II with respect to human eye. List I List II A. Fovea I. Visible coloured portion of eye that regulates diameter of pupil. B. Iris II. External layer of eye formed of dense connective tissue. C.…
Neural Control and Coordination
- Select the correct group/set of Australian Marsupials exhibiting adaptive radiation.
Evolution
- Which of the following statements are correct regarding female reproductive cycle? A. In non-primate mammals cyclical changes during reproduction are called oestrus cycle. B. First menstrual cycle begins at puberty and…
Human Reproduction
- Vital capacity of lung is _________.
Breathing and Exchange of Gases
- Match List I with List II. List I List II A. P-wave I. Beginning of systole B. Q-wave II. Repolarisation of ventricles C. QRS complex III. Depolarisation of atria D. T-wave IV. Depolarisation of ventricles Choose the…
Body Fluids and Circulation
- Given below are two statements: one is labelled as Assertion A and other is labelled as Reason R. Assertion A : Amniocentesis for sex determination is one of the strategies of Reproductive and Child Health Care…
Reproductive Health
- Once the undigested and unabsorbed substances enter the caecum, their backflow is prevented by
Digestion and Absorption
- Match List I with List II. List I List II A. Gene 'a' I. β-galactosidase B. Gene 'y' II. Transacetylase C. Gene 'i' III. Permease D. Gene 'z' IV. Repressor protein Choose the correct answer from the options given below:
Biomolecules
- Match List I with List II List I (Cells) List II (Secretion) A. Peptic cells I. Mucus B. Goblet cells II. Bile juice C. Oxyntic cells III. Proenzyme pepsinogen D. Hepatic cells IV. HCl and intrinsic factor for…
Digestion and Absorption
- Which of the following functions is carried out by cytoskeleton in a cell?
Biomolecules
- Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: Nephrons are of two types: Cortical & Juxta medullary, based on their relative position in cortex and…
Excretory Products and Elimination
- Given below are two statements: Statement I: Electrostatic precipitator is most widely used in thermal power plant Statement II: Electrostatic precipitator in thermal power plant removes ionising radiations In the light…
Human Health and Disease
- Broad palm with single palm crease is visible in a person suffering from-
Evolution
- Radial symmetry is NOT found in adults of phylum ______.
Animal Kingdom
- In which blood corpuscles, the HIV undergoes replication and produces progeny viruses?
Human Health and Disease
- Which of the following is not a cloning vector?
Biomolecules
- Match List I with List II. List I List II A. Logistic growth I. Unlimited resource availability condition B. Exponential growth II. Limited resource availability condition C. Expanding age pyramid III. The percent…
Evolution
- Select the correct statements with reference to chordates. A. Presence of a mid-dorsal, solid and double nerve cord. B. Presence of closed circulatory system. C. Presence of paired pharyngeal gill slits. D. Presence of…
Animal Kingdom
- The parts of human brain that helps in regulation of sexual behaviour, expression of excitement, pleasure, rage, fear etc. are:
Neural Control and Coordination
- The unique mammalian characteristics are:
Animal Kingdom
- Which of the following are NOT under the control of thyroid hormone? A. Maintenance of water and electrolyte balance B. Regulation of basal metabolic rate C. Normal rhythm of sleep-wake cycle D. Development of immune…
Chemical Coordination and Integration
- Select the correct statements. A. Tetrad formation is seen during Leptotene. B. During Anaphase, the centromeres split and chromatids separate. C. Terminalization takes place during Pachytene. D. Nucleolus, Golgi…
Biomolecules
- Match List I with List II. List I List II A. Mast cells I. Ciliated epithelium B. Inner surface of bronchiole II. Areolar connective tissue C. Blood III. Cuboidal epithelium D. Tubular parts of nephron IV. Specialised…
Structural Organisation in Animals
- Which of the following is characteristic feature of cockroach regarding sexual dimorphism?
Structural Organisation in Animals
- Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5'AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'?
Biomolecules
- In cockroach, excretion is brought about by- A. Phallic gland B. Urecose gland C. Nephrocytes D. Fat body E. Collaterial glands Choose the correct answer from the options given below :
Excretory Products and Elimination
- Given below are two statements: Statement I : During G0 phase of cell cycle, the cell is metabolically inactive. Statement II : The centrosome undergoes duplication during S phase of interphase. In the light of the…
Biomolecules
- Which one of the following is NOT an advantage of inbreeding?
Animal Husbandry
- Which of the following statements are correct? A. An excessive loss of body fluid from the body switches off osmoreceptors. B. ADH facilitates water reabsorption to prevent diuresis. C. ANF causes vasodilation. D. ADH…
Excretory Products and Elimination
- Which of the following statements are correct regarding skeletal muscle? A. Muscle bundles are held together by collagenous connective tissue layer called fascicle. B. Sarcoplasmic reticulum of muscle fibre is a store…
Locomotion and Movement
- Which of the following statements are correct? A. Basophils are most abundant cells of the total WBCs B. Basophils secrete histamine, serotonin and heparin C. Basophils are involved in inflammatory response D. Basophils…
Body Fluids and Circulation
Botany
- Given below are two statements : One labelled as Assertion A and the other labelled as Reason R: Assertion A : The first stage of gametophyte in the life cycle of moss is protonema stage. Reason R : Protonema develops…
Plant Kingdom
- In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are :
Sexual Reproduction in Flowering Plants
- Movement and accumulation of ions across a membrane against their concentration gradient can be explained by
Transport in Plants
- Large, colourful, fragrant flowers with nectar are seen in
Sexual Reproduction in Flowering Plants
- The phenomenon of pleiotropism refers to
Principles of Inheritance
- Which hormone promotes internode/petiole elongation in deep water rice?
Plant Growth and Development
- Among 'The Evil Quartet', which one is considered the most important cause driving extinction of species?
Biodiversity and Conservation
- Upon exposure to UV radiation, DNA stained with ethidium bromide will show
Biotechnology
- Which micronutrient is required for splitting of water molecule during photosynthesis?
Mineral Nutrition
- Axile placentation is observed in
Morphology of Flowering Plants
- The process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis?
Cell Cycle and Division
- The reaction centre in PS II has an absorption maxima at
Photosynthesis
- Unequivocal proof that DNA is the genetic material was first proposed by
Molecular Basis of Inheritance
- Among eukaryotes, replication of DNA takes place in :
Molecular Basis of Inheritance
- In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon may be called as
Biotechnology
- Cellulose does not form blue colour with Iodine because
Cell Structure and Function
- Spraying of which of the following phytohormone on juvenile conifers helps hastening the maturity period, that leads early seed production?
Plant Growth and Development
- Given below are two statements : Statement I : The forces generated transpiration can lift a xylem-sized column of water over 130 meters height. Statement II : Transpiration cools leaf surfaces sometimes 10 to 15…
Transport in Plants
- Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the characteristics specific to family Fabaceae but not found in Solanaceae or Liliaceae.
Morphology of Flowering Plants
- Expressed Sequence Tags (ESTs) refers to
Molecular Basis of Inheritance
- Identify the correct statements: A. Detrivores perform fragmentation. B. The humus is further degraded by some microbes during mineralization. C. Water soluble inorganic nutrients go down into the soil and get…
Ecosystem
- The thickness of ozone in a column of air in the atmosphere is measured in terms of :
Biodiversity and Conservation
- Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : Late wood has fewer xylary elements with narrow vessels. Reason R : Cambium is less active in…
Anatomy of Flowering Plants
- Which of the following stages of meiosis involves division of centromere?
Cell Cycle and Division
- The historic Convention on Biological Diversity, 'The Earth Summit' was held in Rio de Janeiro in the year
Biodiversity and Conservation
- How many ATP and NADPH_2 are required for the synthesis of one molecule of Glucose during Calvin cycle?
Photosynthesis
- In the equation GPP − R = NPP GPP is Gross Primary Productivity NPP is Net Primary Productivity R here is ________.
Ecosystem
- During the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out
Biotechnology
- What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
Molecular Basis of Inheritance
- What is the function of tassels in the corn cob?
Sexual Reproduction in Flowering Plants
- Identify the pair of heterosporous pteridophytes among the following :
Plant Kingdom
- In gene gun method used to introduce alien DNA into host cells, microparticles of ________ metal are used.
Biotechnology
- Given below are two statements : Statement I : Endarch and exarch are the terms often used for describing the position of secondary xylem in the plant body. Statement II : Exarch condition is the most common feature of…
Anatomy of Flowering Plants
- Frequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by
Principles of Inheritance
- Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : ATP is used at two steps in glycolysis. Reason R : First ATP is used in converting glucose into…
Respiration in Plants
- Which one of the following statements is NOT correct?
Diversity in Living World
- How many different proteins does the ribosome consist of?
Molecular Basis of Inheritance
- Which of the following statements are correct about Klinefelter's Syndrome? A. This disorder was first described by Langdon Down (1866). B. Such an individual has overall masculine development. However, the feminine…
Principles of Inheritance
- Match List I with List II : List I List II A. Oxidative decarboxylation I. Citrate synthase B. Glycolysis II. Pyruvate dehydrogenase C. Oxidative phosphorylation III. Electron transport system D. Tricarboxylic acid…
Respiration in Plants
- Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : A flower is defined as modified shoot wherein the shoot apical meristem changes to floral meristem.…
Morphology of Flowering Plants
- Given below are two statements : One labelled as Assertion A and the other labelled as Reason R : Assertion A : In gymnosperms the pollen grains are released from the microsporangium and carried by air currents. Reason…
Sexual Reproduction in Flowering Plants
- Match List I with List II : List I List II A. Cohesion I. More attraction in liquid phase B. Adhesion II. Mutual attraction among water molecules C. Surface tension III. Water loss in liquid phase D. Guttation IV.…
Transport in Plants
- Which of the following combinations is required for chemiosmosis?
Photosynthesis
- Melonate inhibits the growth of pathogenic bacteria by inhibiting the activity of
Microbes in Human Welfare
- Identify the correct statements: A. Lenticels are the lens-shaped openings permitting the exchange of gases. B. Bark formed early in the season is called hard bark. C. Bark is a technical term that refers to all tissues…
Anatomy of Flowering Plants
- Match List I with List II : List I List II A. M Phase I. Proteins are synthesized B. G2 Phase II. Inactive phase C. Quiescent stage III. Interval between mitosis and initiation of DNA replication D. G1 Phase IV.…
Cell Cycle and Division
- Match List I with List II : List I (Interaction) List II (Species A and B) A. Mutualism I. +(A), 0(B) B. Commensalism II. –(A), 0(B) C. Amensalism III. +(A), –(B) D. Parasitism IV. +(A), +(B) Choose the correct answer…
Organisms and Populations
- Given below are two statements: Statement I : Gause's 'Competitive Exclusion Principle' states that two closely related species competing for the same resources cannot co-exist indefinitely and competitively inferior…
Organisms and Populations
- Match List I with List II: List I List II A. Iron I. Synthesis of auxin B. Zinc II. Component of nitrate reductase C. Boron III. Activator of catalase D. Molybdenum IV. Cell elongation and differentiation Choose the…
Mineral Nutrition
- Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a correct sequence. A. Insertion of recombinant DNA into the host cell B. Cutting of DNA at specific location by restriction enzyme…
Biotechnology
Chemistry
- Which of the following reactions will NOT give primary amine as the product?
Amines and Nitrogen Compounds
- Match List-I with List-II. List-I List-II A. Coke I. Carbon atoms are sp^3 hybridised B. Diamond II. Used as a dry lubricant C. Fullerene III. Used as a reducing agent D. Graphite IV. Cage like molecules Choose the…
p-Block Elements
- Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R : Assertion A : Metallic sodium dissolves in liquid ammonia giving a deep blue solution, which is paramagnetic.…
Hydrogen and s-Block Elements
- In Lassaigne's extract of an organic compound, both nitrogen and sulphur are present, which gives blood red colour with Fe^3+ due to the formation of
Practical Chemistry
- The conductivity of centimolar solution of KCl at 25°C is 0.0210 ohm^-1 cm^-1 and the resistance of the cell containing the solution at 25°C is 60 ohm. The value of cell constant is
Redox and Electrochemistry
- Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R : Assertion A : A reaction can have zero activation energy. Reason R : The minimum extra amount of energy absorbed by…
Chemical Kinetics
- Which one is an example of heterogenous catalysis?
Surface Chemistry
- Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R Assertion A : Helium is used to dilute oxygen in diving apparatus. Reason R : Helium has high solubility in O_2. In…
Hydrogen and s-Block Elements
- A compound is formed by two elements A and B. The element B forms cubic close packed structure and atoms of A occupy 1/3 of tetrahedral voids. If the formula of the compound is A_xB_y, then the value of x + y is in…
Some Basic Concepts of Chemistry
- Given below are two statements : Statement I : A unit formed by the attachment of a base to 1 position of sugar is known as nucleoside. Statement II : When nucleoside is linked to phosphorous acid at 5-position of sugar…
Biomolecules
- The relation between n_m (n_m = the number of permissible values of magnetic quantum number (m)) for a given value of azimuthal quantum number (l), is
Atomic Structure
- Amongst the following the total number of species NOT having eight electrons around central atom in its outermost shell, is NH_3, AlCl_3, BeCl_2, CCl_4, PCl_5:
Chemical Bonding
- The correct order of energies of molecular orbitals of N_2 molecule, is
Chemical Bonding
- The number of σ bonds, π bonds and lone pair of electrons in pyridine, respectively are:
Chemical Bonding
- Intermolecular forces are forces of attraction and repulsion between interacting particles that will include : A. dipole - dipole forces B. dipole - induced dipole forces C. hydrogen bonding D. covalent bonding E.…
States of Matter
- Which of the following statements are NOT correct? A. Hydrogen is used to reduce heavy metal oxides to metals. B. Heavy water is used to study reaction mechanism. C. Hydrogen is used to make saturated fats from oils. D.…
Hydrogen and s-Block Elements
- Which amongst the following molecules on polymerization produces neoprene?
Polymers
- Some tranquilizers are listed below. Which one from the following belongs to barbiturates?
Chemistry in Everyday Life
- The element expected to form largest ion to achieve the nearest noble gas configuration is
Periodic Classification
- Select the correct statements from the following A. Atoms of all elements are composed of two fundamental particles. B. The mass of the electron is 9.10939 × 10^-31 kg. C. All the isotopes of a given element show same…
Atomic Structure
- The stability of Cu^2+ is more than Cu^+ salts in aqueous solution due to
d- and f-Block Elements
- Which one of the following statements is correct?
d- and f-Block Elements
- Weight (g) of two moles of the organic compound, which is obtained by heating sodium ethanoate with sodium hydroxide in presence of calcium oxide is :
Basic Principles of Organic Chemistry
- Amongst the given options which of the following molecules/ ion acts as a Lewis acid?
Chemical Bonding
- Taking stability as the factor, which one of the following represents correct relationship?
Basic Principles of Organic Chemistry
- Homoleptic complex from the following complexes is
Coordination Compounds
- The right option for the mass of CO_2 produced by heating 20 g of 20% pure limestone is (Atomic mass of Ca = 40) CaCO_3 →[1200 K] CaO + CO_2
Some Basic Concepts of Chemistry
- For a certain reaction, the rate = k[A]^2[B], when the initial concentration of A is tripled keeping concentration of B constant, the initial rate would
Chemical Kinetics
- Match List-I with List-II : List-I (Oxoacids of Sulphur) List-II (Bonds) A. Peroxodisulphuric acid I. Two S–OH, Four S=O, One S–O–S B. Sulphuric acid II. Two S–OH, One S=O C. Pyrosulphuric acid III. Two S–OH, Four S=O,…
p-Block Elements
- Which of the following statements are INCORRECT? A. All the transition metals except scandium form MO oxides which are ionic. B. The highest oxidation number corresponding to the group number in transition metal oxides…
d- and f-Block Elements
- Which complex compound is most stable?
Coordination Compounds
- What fraction of one edge centred octahedral void lies in one unit cell of fcc?
Solutions
- Which amongst the following options is the correct relation between change in enthalpy and change in internal energy?
Chemical Thermodynamics
- On balancing the given redox reaction, aCr_2O_7^2- + bSO_3^2-(aq) + cH^+(aq) arrow 2aCr^3+(aq) + bSO_4^2-(aq) + c/2H_2O(l) the coefficients a, b and c are found to be, respectively-
Redox and Electrochemistry
- The equilibrium concentrations of the species in the reaction A + B leftharpoons C + D are 2, 3, 10 and 6 mol L^-1, respectively at 300 K. Δ G° for the reaction is (R = 2 cal/mol K)
Equilibrium
- Pumice stone is an example of
Surface Chemistry
- Given below are two statements : Statement I : The nutrient deficient water bodies lead to eutrophication Statement II : Eutrophication leads to decrease in the level of oxygen in the water bodies. In the light of the…
Environmental Chemistry
- The reaction that does NOT take place in a blast furnace between 900 K to 1500 K temperature range during extraction of iron is :
General Principles of Metallurgy
Physics
- Let a wire be suspended from the ceiling (rigid support) and stretched by a weight W attached at its free end. The longitudinal stress at any point of cross-sectional area A of the wire is
Properties of Matter
- A football player is moving southward and suddenly turns eastward with the same speed to avoid an opponent. The force that acts on the player while turning is
Laws of Motion
- If ∫ E · dS = 0 over a surface, then
Electrostatics
- The potential energy of a long spring when stretched by 2 cm is U. If the spring is stretched by 8 cm, potential energy stored in it will be
Work Energy and Power
- A 12 V, 60 W lamp is connected to the secondary of a step-down transformer, whose primary is connected to ac mains of 220 V. Assuming the transformer to be ideal, what is the current in the primary winding?
Electromagnetic Induction and AC
- A full wave rectifier circuit consists of two p-n junction diodes, a centre-tapped transformer, capacitor and a load resistance. Which of these components remove the ac ripple from the rectified output?
Semiconductor Electronics
- Light travels a distance x in time t_1 in air and 10x in time t_2 in another denser medium. What is the critical angle for this medium?
Ray Optics
- Resistance of a carbon resistor determined from colour codes is (22000 ± 5%) Ω. The colour of third band must be
Current Electricity
- Given below are two statements: Statement I: Photovoltaic devices can convert optical radiation into electricity. Statement II: Zener diode is designed to operate under reverse bias in breakdown region. In the light of…
Semiconductor Electronics
- The magnetic energy stored in an inductor of inductance 4 muH carrying a current of 2 A is
Electromagnetic Induction and AC
- The angular acceleration of a body, moving along the circumference of a circle, is
Rotational Motion
- A Carnot engine has an efficiency of 50% when its source is at a temperature 327°C. The temperature of the sink is
Thermodynamics
- Two bodies of mass m and 9m are placed at a distance R. The gravitational potential on the line joining the bodies where the gravitational field equals zero, will be (G = gravitational constant)
Gravitation
- A vehicle travels half the distance with speed v and the remaining distance with speed 2v. Its average speed is
Kinematics
- The amount of energy required to form a soap bubble of radius 2 cm from a soap solution is nearly (surface tension of soap solution = 0.03 N m^-1)
Properties of Matter
- The minimum wavelength of X-rays produced by an electron accelerated through a potential difference of V volts is proportional to
Dual Nature of Radiation
- The half life of a radioactive substance is 20 minutes. In how much time, the activity of substance drops to 1/16 th of its initial value?
Atoms and Nuclei
- A metal wire has mass (0.4 ± 0.002) g, radius (0.3 ± 0.001) mm and length (5 ± 0.02) cm. The maximum possible percentage error in the measurement of density will nearly be
Physical World and Measurement
- In a plane electromagnetic wave travelling in free space, the electric field component oscillates sinusoidally at a frequency of 2.0 × 10^10 Hz and amplitude 48 V m^-1. Then the amplitude of oscillating magnetic field…
Electromagnetic Waves
- The temperature of a gas is –50°C. To what temperature the gas should be heated so that the rms speed is increased by 3 times?
Kinetic Theory of Gases
- An ac source is connected to a capacitor C. Due to decrease in its operating frequency
Electromagnetic Induction and AC
- For Young's double slit experiment, two statements are given below: Statement I : If screen is moved away from the plane of slits, angular separation of the fringes remains constant. Statement II : If the monochromatic…
Wave Optics
- In hydrogen spectrum, the shortest wavelength in the Balmer series is λ. The shortest wavelength in the Bracket series is
Atoms and Nuclei
- The work functions of Caesium (Cs), Potassium (K) and Sodium (Na) are 2.14 eV, 2.30 eV and 2.75 eV respectively. If incident electromagnetic radiation has an incident energy of 2.20 eV, which of these photosensitive…
Dual Nature of Radiation
- The errors in the measurement which arise due to unpredictable fluctuations in temperature and voltage supply are
Physical World and Measurement
- In a series LCR circuit, the inductance L is 10 mH, capacitance C is 1 muF and resistance R is 100 Ω. The frequency at which resonance occurs is
Electromagnetic Induction and AC
- The venturi-meter works on
Properties of Matter
- The ratio of frequencies of fundamental harmonic produced by an open pipe to that of closed pipe having the same length is
Oscillations and Waves
- An electric dipole is placed at an angle of 30° with an electric field of intensity 2 × 10^5 N C^-1. It experiences a torque equal to 4 N m. Calculate the magnitude of charge on the dipole, if the dipole length is 2 cm.
Electrostatics
- The net magnetic flux through any closed surface is
Magnetism and Moving Charges
- A bullet is fired from a gun at the speed of 280 m s^-1 in the direction 30° above the horizontal. The maximum height attained by the bullet is (g = 9.8 m s^-2, sin 30° = 0.5)
Kinematics
- Two thin lenses are of same focal lengths (f), but one is convex and the other one is concave. When they are placed in contact with each other, the equivalent focal length of the combination will be
Ray Optics
- A bullet from a gun is fired on a rectangular wooden block with velocity u. When bullet travels 24 cm through the block along its length horizontally, velocity of bullet becomes u/3. Then it further penetrates into the…
Laws of Motion
- A horizontal bridge is built across a river. A student standing on the bridge throws a small ball vertically upwards with a velocity 4 m s^-1. The ball strikes the water surface after 4 s. The height of bridge above…
Kinematics
- 10 resistors, each of resistance R are connected in series to a battery of emf E and negligible internal resistance. Then those are connected in parallel to the same battery, the current is increased n times. The value…
Current Electricity
- A wire carrying a current I along the positive x-axis has length L. It is kept in a magnetic field B = (2i + 3j - 4k) T. The magnitude of the magnetic force acting on the wire is
Magnetism and Moving Charges
- Calculate the maximum acceleration of a moving car so that a body lying on the floor of the car remains stationary. The coefficient of static friction between the body and the floor is 0.15 (g = 10 m s^-2).
Laws of Motion
- The resistance of platinum wire at 0°C is 2 Ω and 6.8 Ω at 80°C. The temperature coefficient of resistance of the wire is
Current Electricity
- The radius of inner most orbit of hydrogen atom is 5.3 × 10^-11 m. What is the radius of third allowed orbit of hydrogen atom?
Atoms and Nuclei
Practise NEET every day
Five real previous-year questions a day, graded as the exam grades. No sign-up.
Start today's five