NEET Biomolecules questions
56 Zoology questions on Biomolecules as asked in NEET, newest first.
- Given below are two statements : Statement I : The DNA fragments extracted from gel electrophoresis can be used in construction of recombinant DNA. Statement II : Smaller size DNA fragments are observed near anode while…
2025
- The blue and white selectable markers have been developed which differentiate recombinant colonies from non-recombinant colonies on the basis of their ability to produce colour in the presence of a chromogenic…
2025
- Match List I with List II: List-I List-II A. Adenosine I. Nitrogen base B. Adenylic acid II. Nucleotide C. Adenine III. Nucleoside D. Alanine IV. Amino acid Choose the option with all correct matches.
2025
- Who proposed that the genetic code for amino acids should be made up of three nucleotides?
2025
- Histones are enriched with -
2025
- The protein portion of an enzyme is called:
2025
- Which of the following enzyme(s) are NOT essential for gene cloning? A. Restriction enzymes B. DNA ligase C. DNA mutase D. DNA recombinase E. DNA polymerase Choose the correct answer from the options given below:
2025
- Which factor is important for termination of transcription?
2025
- Silencing of specific mRNA is possible via RNAi because of
2025
- Which one of the following enzymes contains 'Haem' as the prosthetic group?
2025
- Polymerase chain reaction (PCR) amplifies DNA following the equation.
2025
- From the statements given below choose the correct option : A. The eukaryotic ribosomes are 80S and prokaryotic ribosomes are 70S. B. Each ribosome has two sub-units. C. The two sub-units of 80S ribosome are 60S and 40S…
2025
- Name the class of enzyme that usually catalyze the following reaction : S - G + S^\# arrow S + S^\# - G Where, G arrow a group other than hydrogen S arrow a substrate S^\# arrow another substrate
2025
- Given below are two statements : Statement I : In the RNA world, RNA is considered the first genetic material evolved to carry out essential life processes. RNA acts as a genetic material and also as a catalyst for some…
2025
- Given below are two statements : Statement I : Transfer RNAs and ribosomal RNA do not interact with mRNA. Statement II : RNA interference (RNAi) takes place in all eukaryotic organisms as a method of cellular defence.…
2025
- Which of the following are the post-transcriptional events in an eukaryotic cell? A. Transport of pre-mRNA to cytoplasm prior to splicing. B. Removal of introns and joining of exons. C. Addition of methyl group at 5'…
2025
- Match List I with List II: List-I List-II A. Alfred Hershey and Martha Chase I. Streptococcus pneumoniae B. Euchromatin II. Densely packed and dark-stained C. Frederick Griffith III. Loosely packed and light-stained D.…
2025
- Which chromosome in the human genome has the highest number of genes?
2025
- Which one of the following statements refers to Reductionist Biology?
2025
- The complex II of mitochondrial electron transport chain is also known as
2025
- Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'
2024
- Following are the stages of cell division : A. Gap 2 phase B. Cytokinesis C. Synthesis phase D. Karyokinesis E. Gap 1 phase Choose the correct sequence of stages from the options given below :
2024
- Given below are two statements: Statement I: Mitochondria and chloroplasts both double membranes bound organelles. Statement II: Inner membrane of mitochondria is relatively less permeable, as compared chloroplast. In…
2024
- Regarding catalytic cycle of an enzyme action, select the correct sequential steps : A. Substrate enzyme complex formation. B. Free enzyme ready to bind with another substrate. C. Release of products. D. Chemical bonds…
2024
- Match List I with List II : List I A. RNA polymerase III B. Termination of transcription C. Splicing of Exons D. TATA box List II I. snRNPs II. Promoter III. Rho factor IV. SnRNAs, tRNA Choose the correct answer from…
2024
- Given below are two statements: Statement I: A protein is imagined as a line, the left end represented by first amino acid (C-terminal) and the right end represented by last amino acid (N-terminal). Statement II: Adult…
2023
- Which of the following are NOT considered as the part of endomembrane system? A. Mitochondria B. Endoplasmic reticulum C. Chloroplasts D. Golgi complex E. Peroxisomes Choose the most appropriate answer from the options…
2023
- Given below are two statements : Statement I : Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat. Statement…
2023
- Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA…
2023
- Match List I with List II. List I List II A. Gene 'a' I. β-galactosidase B. Gene 'y' II. Transacetylase C. Gene 'i' III. Permease D. Gene 'z' IV. Repressor protein Choose the correct answer from the options given below:
2023
- Which of the following functions is carried out by cytoskeleton in a cell?
2023
- Which of the following is not a cloning vector?
2023
- Select the correct statements. A. Tetrad formation is seen during Leptotene. B. During Anaphase, the centromeres split and chromatids separate. C. Terminalization takes place during Pachytene. D. Nucleolus, Golgi…
2023
- Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5'AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'?
2023
- Given below are two statements: Statement I : During G0 phase of cell cycle, the cell is metabolically inactive. Statement II : The centrosome undergoes duplication during S phase of interphase. In the light of the…
2023
- If the length of a DNA molecule is 1.1 metres, what will be the approximate number of base pairs?
2022
- Given below are two statements: Statement I: Restriction endonucleases recognise specific sequence to cut DNA known as palindromic nucleotide sequence. Statement II: Restriction endonucleases cut the DNA strand a little…
2022
- In an E. Coli strain i gene gets mutated and its product can not bind the inducer molecule. If growth medium is provided with lactose, what will be the outcome?
2022
- A dehydration reaction links two glucose molecules to product maltose. If the formula for glucose is C_6H_12O_6 then what is the formula for maltose?
2022
- Which of the following statements with respect to Endoplasmic Reticulum is incorrect?
2022
- Select the incorrect statement with reference to mitosis:
2022
- Match List-I with List-II List-I (Biological Molecules) List-II (Biological functions) (a) Glycogen (i) Hormone (b) Globulin (ii) Biocatalyst (c) Steroids (iii) Antibody (d) Thrombin (iv) Storage product Choose the…
2022
- Ten E.coli cells with ^15N - dsDNA are incubated in medium containing ^14N nucleotide. After 60 minutes, how many E.coli cells will have DNA totally free from ^15N?
2022
- Name the enzyme that facilitates opening of DNA helix during transcription.
2020
- Identify the correct statement with regard to G1 phase (Gap 1) of interphase.
2020
- Which of the following statements is not correct?
2020
- Select the correct statement.
2020
- Match the following columns and select the correct option. Column-I Column-II (a) Bt cotton (i) Gene therapy (b) Adenosine deaminase deficiency (ii) Cellular defence (c) RNAi (iii) Detection of HIV infection (d) PCR…
2020
- Which one of the following is the most abundant protein in the animals?
2020
- If the distance between two consecutive base pairs is 0.34 nm and the total number of base pairs of a DNA double helix in a typical mammalian cell is 6.6 × 10^9 bp, then the length of the DNA is approximately
2020
- The first phase of translation is
2020
- Which of the following statements is correct?
2020
- Identify the substances having glycosidic bond and peptide bond, respectively in their structure
2020
- Which is the important site of formation of glycoproteins and glycolipids in eukaryotic cells?
2020
- Identify the basic amino acid from the following.
2020
- In gel electrophoresis, separated DNA fragments can be visualized with the help of
2020
Practise Biomolecules the way it is asked
A timed set of real NEET Biomolecules questions, graded as the exam grades. No sign-up.
Start a Biomolecules test